Basic information for Gm37315-201-10aa
| Peptide Name | Gm37315-201-10aa |
| Genome Position | chr1:20064402-20064431[-] |
| Species | Mouse |
| Peptide Sequence | MEVALICGQF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.41 |
| Relative Molecular Mass | 1272.49 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000104095;Gm37315 |
| Transcript ID/Name | ENSMUST00000194347;Gm37315-201 |
| Transcript Length | 3479 |
| Coding Ability | 0.4231 |
| DNA Sequence Corresponding to Peptide | ATGGAAGTGGCTTTAATATGTGGTCAGTTT |
|
Conservation
|
|
|