Basic information for Gm37420-201-10aa-2
| Peptide Name | Gm37420-201-10aa-2 |
| Genome Position | chr14:61669892-61669921[-] |
| Species | Mouse |
| Peptide Sequence | MLFLRKVPWF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.84 |
| Relative Molecular Mass | 1498.82 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000103869;Gm37420 |
| Transcript ID/Name | ENSMUST00000195332;Gm37420-201 |
| Transcript Length | 2912 |
| Coding Ability | 0.3036 |
| DNA Sequence Corresponding to Peptide | ATGCTTTTCCTTAGAAAAGTTCCTTGGTTT |
|
Conservation
|
|
|