Basic information for Gm37494-202-10aa-2
| Peptide Name | Gm37494-202-10aa-2 |
| Genome Position | chr7:39575879-39575908[+] |
| Species | Mouse |
| Peptide Sequence | MYVLLYISTL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.79 |
| Relative Molecular Mass | 1377.67 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000108621;Gm37494 |
| Transcript ID/Name | ENSMUST00000188038;Gm37494-202 |
| Transcript Length | 16021 |
| Coding Ability | 0.4374 |
| DNA Sequence Corresponding to Peptide | ATGTATGTATTATTATACATAAGTACACTG |
m6A
|
Conservation
|
|
|