Basic information for Gm37494-202-10aa-3
| Peptide Name | Gm37494-202-10aa-3 |
| Genome Position | chr7:39574674-39574703[+] |
| Species | Mouse |
| Peptide Sequence | MTTLIQENIL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.66 |
| Relative Molecular Mass | 1337.61 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000108621;Gm37494 |
| Transcript ID/Name | ENSMUST00000188038;Gm37494-202 |
| Transcript Length | 16021 |
| Coding Ability | 0.4374 |
| DNA Sequence Corresponding to Peptide | ATGACAACTCTTATACAGGAAAACATTTTG |
|
Conservation
|
|
|