Basic information for Gm37530-201-10aa-3
| Peptide Name | Gm37530-201-10aa-3 |
| Genome Position | chr4:42038876-42038905[+] |
| Species | Mouse |
| Peptide Sequence | MGVLGSLQIA |
| Peptide Length | 10 |
| Unique | No (Gm21955-201-10aa-3) |
| Grand Average of Hydropathicity | 1.49 |
| Relative Molecular Mass | 1150.34 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000103694;Gm37530 |
| Transcript ID/Name | ENSMUST00000191759;Gm37530-201 |
| Transcript Length | 4932 |
| Coding Ability | 0.4815 |
| DNA Sequence Corresponding to Peptide | ATGGGGGTCCTAGGTTCCTTACAGATTGCA |
|
Conservation
|
|
|