Basic information for Gm37570-201-10aa-2
| Peptide Name | Gm37570-201-10aa-2 |
| Genome Position | chr1:66765955-66765984[-] |
| Species | Mouse |
| Peptide Sequence | MVSEQSKILF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.47 |
| Relative Molecular Mass | 1343.54 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000102559;Gm37570 |
| Transcript ID/Name | ENSMUST00000195411;Gm37570-201 |
| Transcript Length | 3106 |
| Coding Ability | 0.3957 |
| DNA Sequence Corresponding to Peptide | ATGGTTTCTGAGCAATCCAAAATCCTGTTC |
m6A
|
Conservation
|
|
|