Basic information for Gm37607-201-10aa
| Peptide Name | Gm37607-201-10aa |
| Genome Position | chr1:58384929-58384958[-] |
| Species | Mouse |
| Peptide Sequence | MFNFIEFLLF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.82 |
| Relative Molecular Mass | 1482.73 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000103839;Gm37607 |
| Transcript ID/Name | ENSMUST00000194925;Gm37607-201 |
| Transcript Length | 2623 |
| Coding Ability | 0.4053 |
| DNA Sequence Corresponding to Peptide | ATGTTTAACTTCATAGAGTTTTTGTTATTT |
m6A
|
Conservation
|
|
|