Basic information for Gm37621-201-10aa-2
| Peptide Name | Gm37621-201-10aa-2 |
| Genome Position | chr9:101121917-101121946[+] |
| Species | Mouse |
| Peptide Sequence | MLSLCISLCS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.04 |
| Relative Molecular Mass | 1231.48 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000103672;Gm37621 |
| Transcript ID/Name | ENSMUST00000194716;Gm37621-201 |
| Transcript Length | 5531 |
| Coding Ability | 0.4233 |
| DNA Sequence Corresponding to Peptide | ATGTTATCACTATGTATATCACTATGTTCG |
|
Conservation
|
|
|