Basic information for Gm37696-201-10aa-3
| Peptide Name | Gm37696-201-10aa-3 |
| Genome Position | chr3:61358631-61358660[-] |
| Species | Mouse |
| Peptide Sequence | MYLLLYVSTL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.72 |
| Relative Molecular Mass | 1377.67 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000103473;Gm37696 |
| Transcript ID/Name | ENSMUST00000194223;Gm37696-201 |
| Transcript Length | 3349 |
| Coding Ability | 0.3816 |
| DNA Sequence Corresponding to Peptide | ATGTATTTATTATTATATGTAAGTACACTG |
|
Conservation
|
|
|