Basic information for Gm37789-201-10aa-3
| Peptide Name | Gm37789-201-10aa-3 |
| Genome Position | chr1:103726169-103726198[+] |
| Species | Mouse |
| Peptide Sequence | MLFKISHSLS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.73 |
| Relative Molecular Mass | 1324.53 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000102325;Gm37789 |
| Transcript ID/Name | ENSMUST00000192862;Gm37789-201 |
| Transcript Length | 2889 |
| Coding Ability | 0.4005 |
| DNA Sequence Corresponding to Peptide | ATGCTTTTCAAAATCAGCCATAGTCTGTCC |
|
Conservation
|
|
|