Basic information for Gm37824-201-10aa-3
| Peptide Name | Gm37824-201-10aa-3 |
| Genome Position | chr2:13006620-13006649[+] |
| Species | Mouse |
| Peptide Sequence | MSVACPPITL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.4 |
| Relative Molecular Mass | 1193.46 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000104459;Gm37824 |
| Transcript ID/Name | ENSMUST00000193430;Gm37824-201 |
| Transcript Length | 3236 |
| Coding Ability | 0.2812 |
| DNA Sequence Corresponding to Peptide | ATGTCAGTAGCCTGTCCACCCATCACACTC |
m6A
|
Conservation
|
|
|