Basic information for Gm37903-201-10aa-2
| Peptide Name | Gm37903-201-10aa-2 |
| Genome Position | chr1:137529683-137529712[-] |
| Species | Mouse |
| Peptide Sequence | MWFLSLSLFI |
| Peptide Length | 10 |
| Unique | No (Gm4117-201-10aa-19,Gm47578-201-10aa-2) |
| Grand Average of Hydropathicity | 2.09 |
| Relative Molecular Mass | 1418.67 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000103070;Gm37903 |
| Transcript ID/Name | ENSMUST00000192122;Gm37903-201 |
| Transcript Length | 2381 |
| Coding Ability | 0.3419 |
| DNA Sequence Corresponding to Peptide | ATGTGGTTTTTGTCTTTGAGTTTGTTTATA |
|
Conservation
|
|
|