Basic information for Gm37953-201-10aa-2
| Peptide Name | Gm37953-201-10aa-2 |
| Genome Position | chr9:101150470-101150499[+] |
| Species | Mouse |
| Peptide Sequence | MFTIGSDFVN |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.73 |
| Relative Molecular Mass | 1292.45 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000104061;Gm37953 |
| Transcript ID/Name | ENSMUST00000195293;Gm37953-201 |
| Transcript Length | 1884 |
| Coding Ability | 0.3774 |
| DNA Sequence Corresponding to Peptide | ATGTTTACAATAGGAAGTGATTTTGTAAAT |
|
Conservation
|
|
|