Basic information for Gm37962-201-10aa-1
| Peptide Name | Gm37962-201-10aa-1 |
| Genome Position | chr9:101115627-101115656[+] |
| Species | Mouse |
| Peptide Sequence | MRSDSLFWCI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.5 |
| Relative Molecular Mass | 1419.6 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000104392;Gm37962 |
| Transcript ID/Name | ENSMUST00000195535;Gm37962-201 |
| Transcript Length | 2034 |
| Coding Ability | 0.3805 |
| DNA Sequence Corresponding to Peptide | ATGAGATCTGACTCCCTCTTCTGGTGCATC |
|
Conservation
|
|
|