Basic information for Gm38020-201-10aa
| Peptide Name | Gm38020-201-10aa |
| Genome Position | chrX:103577701-103577730[-] |
| Species | Mouse |
| Peptide Sequence | MIFLSQVVCV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.38 |
| Relative Molecular Mass | 1300.59 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000103697;Gm38020 |
| Transcript ID/Name | ENSMUST00000193066;Gm38020-201 |
| Transcript Length | 4676 |
| Coding Ability | 0.4038 |
| DNA Sequence Corresponding to Peptide | ATGATTTTTTTAAGCCAGGTTGTCTGTGTG |
|
Conservation
|
|
|