Basic information for Gm38067-201-10aa
| Peptide Name | Gm38067-201-10aa |
| Genome Position | chr1:131916206-131916235[+] |
| Species | Mouse |
| Peptide Sequence | MKKALEICGG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.24 |
| Relative Molecular Mass | 1211.45 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000103569;Gm38067 |
| Transcript ID/Name | ENSMUST00000192346;Gm38067-201 |
| Transcript Length | 1911 |
| Coding Ability | 0.4505 |
| DNA Sequence Corresponding to Peptide | ATGAAGAAGGCACTTGAAATCTGTGGTGGG |
m6A
|
Conservation
|
|
|