Basic information for Gm38162-201-10aa-1
| Peptide Name | Gm38162-201-10aa-1 |
| Genome Position | chr1:66779003-66779032[+] |
| Species | Mouse |
| Peptide Sequence | MLKPLSSSIF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.89 |
| Relative Molecular Mass | 1284.5 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000102776;Gm38162 |
| Transcript ID/Name | ENSMUST00000195562;Gm38162-201 |
| Transcript Length | 4597 |
| Coding Ability | 0.3559 |
| DNA Sequence Corresponding to Peptide | ATGTTGAAACCTCTTAGTTCCTCTATCTTT |
m6A
|
Conservation
|
|
|