Basic information for Gm38190-201-10aa-2
| Peptide Name | Gm38190-201-10aa-2 |
| Genome Position | chr1:165234988-165235017[-] |
| Species | Mouse |
| Peptide Sequence | MVVQAFNLST |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.02 |
| Relative Molecular Mass | 1271.48 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000102302;Gm38190 |
| Transcript ID/Name | ENSMUST00000192350;Gm38190-201 |
| Transcript Length | 4755 |
| Coding Ability | 0.356 |
| DNA Sequence Corresponding to Peptide | ATGGTGGTGCAGGCCTTTAATCTCAGCACT |
|
Conservation
|
|
|