Basic information for Gm38227-201-10aa-1
| Peptide Name | Gm38227-201-10aa-1 |
| Genome Position | chr3:96263954-96263983[+] |
| Species | Mouse |
| Peptide Sequence | MLLRSFPQVL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.99 |
| Relative Molecular Mass | 1365.63 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000103940;Gm38227 |
| Transcript ID/Name | ENSMUST00000193036;Gm38227-201 |
| Transcript Length | 1602 |
| Coding Ability | 0.4919 |
| DNA Sequence Corresponding to Peptide | ATGCTGCTACGCTCGTTTCCACAAGTCCTT |
m6A
|
Conservation
|
|
|