Basic information for Gm38253-201-10aa-4
| Peptide Name | Gm38253-201-10aa-4 |
| Genome Position | chr3:106727634-106727663[+] |
| Species | Mouse |
| Peptide Sequence | MEISTLWSSS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.19 |
| Relative Molecular Mass | 1302.42 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000102780;Gm38253 |
| Transcript ID/Name | ENSMUST00000194058;Gm38253-201 |
| Transcript Length | 4678 |
| Coding Ability | 0.3427 |
| DNA Sequence Corresponding to Peptide | ATGGAAATATCCACACTTTGGTCTTCTTCT |
|
Conservation
|
|
|