Basic information for Gm38359-201-10aa-1
| Peptide Name | Gm38359-201-10aa-1 |
| Genome Position | chr1:181967909-181967938[-] |
| Species | Mouse |
| Peptide Sequence | MYLLLYISTL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.75 |
| Relative Molecular Mass | 1391.69 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000103317;Gm38359 |
| Transcript ID/Name | ENSMUST00000191884;Gm38359-201 |
| Transcript Length | 2225 |
| Coding Ability | 0.4009 |
| DNA Sequence Corresponding to Peptide | ATGTACTTATTATTATATATAAGTACACTG |
|
Conservation
|
|
|