Basic information for Gm38366-201-10aa-1
| Peptide Name | Gm38366-201-10aa-1 |
| Genome Position | chr9:108531270-108531299[+] |
| Species | Mouse |
| Peptide Sequence | MASLLHIVHS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.2 |
| Relative Molecular Mass | 1269.46 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000103621;Gm38366 |
| Transcript ID/Name | ENSMUST00000193127;Gm38366-201 |
| Transcript Length | 1934 |
| Coding Ability | 0.3097 |
| DNA Sequence Corresponding to Peptide | ATGGCCTCCCTTCTCCACATTGTACACTCA |
m6A
|
Conservation
|
|
|