Basic information for Gm38948-201-10aa-1
| Peptide Name | Gm38948-201-10aa-1 |
| Genome Position | chr7:15971964-15971970,15980743-15980765[+] |
| Species | Mouse |
| Peptide Sequence | MLSLGHSLTP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.58 |
| Relative Molecular Mass | 1217.42 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000109984;Gm38948 |
| Transcript ID/Name | ENSMUST00000210035;Gm38948-201 |
| Transcript Length | 688 |
| Coding Ability | 0.5276 |
| DNA Sequence Corresponding to Peptide | ATGCTCAGCCTGGGCCACAGTCTGACTCCT |
m6A
|
Conservation
|
|
|