Basic information for Gm40264-202-10aa-1
| Peptide Name | Gm40264-202-10aa-1 |
| Genome Position | chr5:9039364-9039393[+] |
| Species | Mouse |
| Peptide Sequence | MLQNWLSGLA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.6 |
| Relative Molecular Mass | 1294.46 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000114430;Gm40264 |
| Transcript ID/Name | ENSMUST00000225021;Gm40264-202 |
| Transcript Length | 2663 |
| Coding Ability | 0.3703 |
| DNA Sequence Corresponding to Peptide | ATGCTTCAGAACTGGCTATCAGGTCTTGCA |
|
Conservation
|
|
|