Basic information for Gm4117-201-10aa-5
| Peptide Name | Gm4117-201-10aa-5 |
| Genome Position | chr13:89809389-89809418[+] |
| Species | Mouse |
| Peptide Sequence | MILLLDFCTT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.82 |
| Relative Molecular Mass | 1331.66 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000089940;Gm4117 |
| Transcript ID/Name | ENSMUST00000044500;Gm4117-201 |
| Transcript Length | 52401 |
| Coding Ability | 0.3749 |
| DNA Sequence Corresponding to Peptide | ATGATTCTACTTCTTGACTTTTGTACTACA |
|
Conservation
|
|
|