Basic information for Gm41414-201-10aa
| Peptide Name | Gm41414-201-10aa |
| Genome Position | chr16:5450534-5450563[+] |
| Species | Mouse |
| Peptide Sequence | MRAVGGSPIT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.4 |
| Relative Molecular Mass | 1150.34 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000116029;Gm41414 |
| Transcript ID/Name | ENSMUST00000229837;Gm41414-201 |
| Transcript Length | 710 |
| Coding Ability | 0.5324 |
| DNA Sequence Corresponding to Peptide | ATGAGAGCAGTTGGAGGAAGCCCCATCACC |
|
Conservation
|
|
|