Basic information for Gm42437-201-10aa
| Peptide Name | Gm42437-201-10aa |
| Genome Position | chr3:41005750-41005779[-] |
| Species | Mouse |
| Peptide Sequence | MNILSVFGHF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.21 |
| Relative Molecular Mass | 1326.52 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000105674;Gm42437 |
| Transcript ID/Name | ENSMUST00000197263;Gm42437-201 |
| Transcript Length | 923 |
| Coding Ability | 0.5005 |
| DNA Sequence Corresponding to Peptide | ATGAATATACTTTCAGTGTTTGGTCACTTC |
|
Conservation
|
|
|