Basic information for Gm42508-201-10aa-2
| Peptide Name | Gm42508-201-10aa-2 |
| Genome Position | chr3:97265222-97265251[+] |
| Species | Mouse |
| Peptide Sequence | MLSQGVPLKF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.63 |
| Relative Molecular Mass | 1281.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000106536;Gm42508 |
| Transcript ID/Name | ENSMUST00000199972;Gm42508-201 |
| Transcript Length | 3292 |
| Coding Ability | 0.3065 |
| DNA Sequence Corresponding to Peptide | ATGCTATCTCAGGGGGTTCCTCTGAAGTTT |
|
Conservation
|
|
|