Basic information for Gm42519-201-10aa-1
| Peptide Name | Gm42519-201-10aa-1 |
| Genome Position | chr5:45245429-45245458[-] |
| Species | Mouse |
| Peptide Sequence | MNVAALVFGA |
| Peptide Length | 10 |
| Unique | No (AC160336.1-201-10aa-8) |
| Grand Average of Hydropathicity | 1.84 |
| Relative Molecular Mass | 1154.33 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000105247;Gm42519 |
| Transcript ID/Name | ENSMUST00000199282;Gm42519-201 |
| Transcript Length | 3656 |
| Coding Ability | 0.3367 |
| DNA Sequence Corresponding to Peptide | ATGAATGTGGCTGCCCTTGTATTTGGAGCA |
|
Conservation
|
|
|