Basic information for Gm42692-201-10aa-1
| Peptide Name | Gm42692-201-10aa-1 |
| Genome Position | chr3:34644353-34644382[+] |
| Species | Mouse |
| Peptide Sequence | MNCLKYLAVK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.54 |
| Relative Molecular Mass | 1344.64 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000104901;Gm42692 |
| Transcript ID/Name | ENSMUST00000199482;Gm42692-201 |
| Transcript Length | 2833 |
| Coding Ability | 0.3036 |
| DNA Sequence Corresponding to Peptide | ATGAATTGCCTAAAATATTTGGCTGTCAAG |
m6A
|
Conservation
|
|
|