Basic information for Gm42692-201-10aa-3
| Peptide Name | Gm42692-201-10aa-3 |
| Genome Position | chr3:34645539-34645568[+] |
| Species | Mouse |
| Peptide Sequence | MHFPVVICVS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.87 |
| Relative Molecular Mass | 1293.56 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000104901;Gm42692 |
| Transcript ID/Name | ENSMUST00000199482;Gm42692-201 |
| Transcript Length | 2833 |
| Coding Ability | 0.3036 |
| DNA Sequence Corresponding to Peptide | ATGCATTTCCCTGTCGTCATCTGTGTTTCC |
|
Conservation
|
|
|