Basic information for Gm42729-201-10aa
| Peptide Name | Gm42729-201-10aa |
| Genome Position | chr5:65625269-65625298[+] |
| Species | Mouse |
| Peptide Sequence | MRSDVLFWCV |
| Peptide Length | 10 |
| Unique | No (Platr9-201-10aa,AABR07040953.1-201-10aa) |
| Grand Average of Hydropathicity | 0.97 |
| Relative Molecular Mass | 1417.64 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000106696;Gm42729 |
| Transcript ID/Name | ENSMUST00000201770;Gm42729-201 |
| Transcript Length | 2930 |
| Coding Ability | 0.4369 |
| DNA Sequence Corresponding to Peptide | ATGAGATCTGATGTCCTCTTCTGGTGTGTC |
|
Conservation
|
|
|