Basic information for Gm42770-201-10aa-1
| Peptide Name | Gm42770-201-10aa-1 |
| Genome Position | chr5:49124743-49124772[-] |
| Species | Mouse |
| Peptide Sequence | MTFLPFLLVL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.46 |
| Relative Molecular Mass | 1355.71 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000105983;Gm42770 |
| Transcript ID/Name | ENSMUST00000199657;Gm42770-201 |
| Transcript Length | 4155 |
| Coding Ability | 0.4558 |
| DNA Sequence Corresponding to Peptide | ATGACATTTTTGCCTTTTTTATTAGTGTTG |
m6A
|
Conservation
|
|
|