Basic information for Gm43318-201-10aa-2
| Peptide Name | Gm43318-201-10aa-2 |
| Genome Position | chr5:48949414-48949443[-] |
| Species | Mouse |
| Peptide Sequence | MLIYYCTLVP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.58 |
| Relative Molecular Mass | 1377.7 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000105974;Gm43318 |
| Transcript ID/Name | ENSMUST00000199939;Gm43318-201 |
| Transcript Length | 1949 |
| Coding Ability | 0.3551 |
| DNA Sequence Corresponding to Peptide | ATGTTAATTTACTACTGTACTTTAGTACCC |
m6A
|
Conservation
|
|
|