Basic information for Gm43473-201-10aa-3
| Peptide Name | Gm43473-201-10aa-3 |
| Genome Position | chr3:151119136-151119165[-] |
| Species | Mouse |
| Peptide Sequence | MSLVAKSGIL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.41 |
| Relative Molecular Mass | 1180.4 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000104816;Gm43473 |
| Transcript ID/Name | ENSMUST00000200442;Gm43473-201 |
| Transcript Length | 5997 |
| Coding Ability | 0.4007 |
| DNA Sequence Corresponding to Peptide | ATGAGCCTTGTGGCCAAGAGTGGAATACTA |
|
Conservation
|
|
|