Basic information for Gm43570-201-10aa-2
| Peptide Name | Gm43570-201-10aa-2 |
| Genome Position | chr3:59003805-59003834[-] |
| Species | Mouse |
| Peptide Sequence | MRLNPLLSLS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.59 |
| Relative Molecular Mass | 1305.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000105945;Gm43570 |
| Transcript ID/Name | ENSMUST00000199951;Gm43570-201 |
| Transcript Length | 3688 |
| Coding Ability | 0.407 |
| DNA Sequence Corresponding to Peptide | ATGAGGCTAAATCCATTACTCAGTCTGAGC |
|
Conservation
|
|
|