Basic information for Gm43588-201-10aa
| Peptide Name | Gm43588-201-10aa |
| Genome Position | chr6:85634351-85634380[+] |
| Species | Mouse |
| Peptide Sequence | MLQSFNLLHD |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.16 |
| Relative Molecular Mass | 1379.53 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000107370;Gm43588 |
| Transcript ID/Name | ENSMUST00000201862;Gm43588-201 |
| Transcript Length | 2298 |
| Coding Ability | 0.2846 |
| DNA Sequence Corresponding to Peptide | ATGTTACAAAGTTTTAATTTGTTACATGAT |
m6A
|
Conservation
|
|
|