Basic information for Gm43745-201-10aa-2
| Peptide Name | Gm43745-201-10aa-2 |
| Genome Position | chr3:107886598-107886627[+] |
| Species | Mouse |
| Peptide Sequence | MLSLCHLSTD |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.68 |
| Relative Molecular Mass | 1281.48 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000105456;Gm43745 |
| Transcript ID/Name | ENSMUST00000198085;Gm43745-201 |
| Transcript Length | 1883 |
| Coding Ability | 0.4971 |
| DNA Sequence Corresponding to Peptide | ATGCTTTCACTCTGCCACCTTAGCACTGAC |
|
Conservation
|
|
|