Basic information for Gm43766-201-10aa-3
| Peptide Name | Gm43766-201-10aa-3 |
| Genome Position | chr14:52262345-52262374[+] |
| Species | Mouse |
| Peptide Sequence | MLRSTVLTTS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.55 |
| Relative Molecular Mass | 1270.56 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000105868;Gm43766 |
| Transcript ID/Name | ENSMUST00000200590;Gm43766-201 |
| Transcript Length | 5417 |
| Coding Ability | 0.3303 |
| DNA Sequence Corresponding to Peptide | ATGCTAAGAAGTACTGTGTTAACAACTTCG |
|
Conservation
|
|
|