Basic information for Gm43813-202-10aa-2
| Peptide Name | Gm43813-202-10aa-2 |
| Genome Position | chr5:123411023-123411052[+] |
| Species | Mouse |
| Peptide Sequence | MVHNLLFWEI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.99 |
| Relative Molecular Mass | 1463.69 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000106636;Gm43813 |
| Transcript ID/Name | ENSMUST00000200134;Gm43813-202 |
| Transcript Length | 5378 |
| Coding Ability | 0.3486 |
| DNA Sequence Corresponding to Peptide | ATGGTTCACAATCTTCTGTTCTGGGAGATC |
|
Conservation
|
|
|