Basic information for Gm43813-202-10aa-3
| Peptide Name | Gm43813-202-10aa-3 |
| Genome Position | chr5:123411749-123411778[+] |
| Species | Mouse |
| Peptide Sequence | MGSDALFWCV |
| Peptide Length | 10 |
| Unique | No (Gm12976-201-10aa,Gm12976-202-10aa,9330158H04Rik-206-10aa-4,C730034F03Rik-201-10aa-1,Gm29480-201-10aa-2,Gm43331-201-10aa,Gm43423-201-10aa-1,C730045M19Rik-201-10aa,Gm44153-201-10aa,Gm15624-203-10aa-2,Gm34121-202-10aa-3,Gm2788-203-10aa-2,Gm47643-201-10aa-1,9630050E16Rik-201-10aa-4,AABR07014638.1-201-10aa,AC096430.2-202-10aa,LOC102549506-201-10aa-1,AABR07072374.2-201-10aa-2,LOC108351520-201-10aa-2) |
| Grand Average of Hydropathicity | 1.14 |
| Relative Molecular Mass | 1290.45 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000106636;Gm43813 |
| Transcript ID/Name | ENSMUST00000200134;Gm43813-202 |
| Transcript Length | 5378 |
| Coding Ability | 0.3486 |
| DNA Sequence Corresponding to Peptide | ATGGGATCTGATGCCCTCTTCTGGTGTGTC |
|
Conservation
|
|
|