Basic information for Gm44189-201-10aa-1
| Peptide Name | Gm44189-201-10aa-1 |
| Genome Position | chr6:102176107-102176136[-] |
| Species | Mouse |
| Peptide Sequence | MIVSIHFCIC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.34 |
| Relative Molecular Mass | 1327.63 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000108092;Gm44189 |
| Transcript ID/Name | ENSMUST00000204387;Gm44189-201 |
| Transcript Length | 3083 |
| Coding Ability | 0.3458 |
| DNA Sequence Corresponding to Peptide | ATGATTGTGAGCATCCACTTCTGTATTTGC |
|
Conservation
|
|
|