Basic information for Gm4430-202-10aa
| Peptide Name | Gm4430-202-10aa |
| Genome Position | chr2:129197047-129197076[-] |
| Species | Mouse |
| Peptide Sequence | MGPDALFWCV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.06 |
| Relative Molecular Mass | 1300.49 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000103532;Gm4430 |
| Transcript ID/Name | ENSMUST00000193902;Gm4430-202 |
| Transcript Length | 1041 |
| Coding Ability | 0.561 |
| DNA Sequence Corresponding to Peptide | ATGGGACCCGATGCCCTCTTCTGGTGTGTC |
|
Conservation
|
|
|