Basic information for Gm44831-201-10aa-1
| Peptide Name | Gm44831-201-10aa-1 |
| Genome Position | chr7:59630488-59630517[-] |
| Species | Mouse |
| Peptide Sequence | MILCILNTFK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.57 |
| Relative Molecular Mass | 1357.71 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000109575;Gm44831 |
| Transcript ID/Name | ENSMUST00000208469;Gm44831-201 |
| Transcript Length | 2989 |
| Coding Ability | 0.5186 |
| DNA Sequence Corresponding to Peptide | ATGATTCTATGTATTTTGAATACTTTTAAA |
|
Conservation
|
|
|