Basic information for Gm44894-201-10aa-1
| Peptide Name | Gm44894-201-10aa-1 |
| Genome Position | chr7:55026754-55026783[+] |
| Species | Mouse |
| Peptide Sequence | MLPSHSVFFS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.83 |
| Relative Molecular Mass | 1313.47 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000108756;Gm44894 |
| Transcript ID/Name | ENSMUST00000205280;Gm44894-201 |
| Transcript Length | 2174 |
| Coding Ability | 0.5708 |
| DNA Sequence Corresponding to Peptide | ATGCTTCCCAGCCATTCAGTATTCTTCAGT |
m6A
|
Conservation
|
|
|