Basic information for Gm44926-201-10aa
| Peptide Name | Gm44926-201-10aa |
| Genome Position | chr7:87774122-87774151[+] |
| Species | Mouse |
| Peptide Sequence | MTWRIYALIK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.52 |
| Relative Molecular Mass | 1456.77 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000108983;Gm44926 |
| Transcript ID/Name | ENSMUST00000207898;Gm44926-201 |
| Transcript Length | 1826 |
| Coding Ability | 0.3012 |
| DNA Sequence Corresponding to Peptide | ATGACATGGAGAATTTACGCTTTAATTAAA |
m6A
|
Conservation
|
|
|