Basic information for Gm44997-201-10aa-1
| Peptide Name | Gm44997-201-10aa-1 |
| Genome Position | chr7:42573702-42573731[-] |
| Species | Mouse |
| Peptide Sequence | MIVIIHFCIC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.87 |
| Relative Molecular Mass | 1353.71 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000108446;Gm44997 |
| Transcript ID/Name | ENSMUST00000205775;Gm44997-201 |
| Transcript Length | 3535 |
| Coding Ability | 0.4526 |
| DNA Sequence Corresponding to Peptide | ATGATTGTGATCATCCACTTCTGTATTTGC |
|
Conservation
|
|
|