Basic information for Gm45033-201-10aa-1
| Peptide Name | Gm45033-201-10aa-1 |
| Genome Position | chr7:116396626-116396655[-] |
| Species | Mouse |
| Peptide Sequence | MVLAPLSKIG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.33 |
| Relative Molecular Mass | 1190.44 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000108500;Gm45033 |
| Transcript ID/Name | ENSMUST00000206710;Gm45033-201 |
| Transcript Length | 3167 |
| Coding Ability | 0.3761 |
| DNA Sequence Corresponding to Peptide | ATGGTTTTAGCTCCTTTGTCAAAGATCGGG |
|
Conservation
|
|
|