Basic information for Gm45159-201-10aa-10
| Peptide Name | Gm45159-201-10aa-10 |
| Genome Position | chr7:90921564-90921593[+] |
| Species | Mouse |
| Peptide Sequence | MFKLLLKAVI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.88 |
| Relative Molecular Mass | 1337.7 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000109125;Gm45159 |
| Transcript ID/Name | ENSMUST00000208630;Gm45159-201 |
| Transcript Length | 25241 |
| Coding Ability | 0.3769 |
| DNA Sequence Corresponding to Peptide | ATGTTCAAGCTGCTTTTAAAAGCAGTTATA |
|
Conservation
|
|
|