Basic information for Gm45179-201-10aa-1
| Peptide Name | Gm45179-201-10aa-1 |
| Genome Position | chr7:91050200-91050229[+] |
| Species | Mouse |
| Peptide Sequence | MFIVAKLLSS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.73 |
| Relative Molecular Mass | 1270.52 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000108956;Gm45179 |
| Transcript ID/Name | ENSMUST00000208452;Gm45179-201 |
| Transcript Length | 4337 |
| Coding Ability | 0.4353 |
| DNA Sequence Corresponding to Peptide | ATGTTTATTGTTGCTAAGCTTCTCAGTTCA |
|
Conservation
|
|
|